View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_116 (Length: 257)
Name: NF16091_high_116
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_116 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 239
Target Start/End: Original strand, 53474569 - 53474793
Alignment:
| Q |
15 |
gagatgaagggtggaactactactactactcaagctgtggtgaatagtaatggtaactttgtgnnnnnnnnnnnnnnnnnnnctgtctcaagctttaaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53474569 |
gagatgaagggtggaactactactactactcaagctgtggtgaatagtaatggtaactttgtggaagaagaagaagaagaagctgtctcaagctttaaat |
53474668 |
T |
|
| Q |
115 |
tttcataccttcttgcttccaaggatcgtgattttctcctatcatcaactggaactcaggttctttatctttctatacctctcaccacttcagttttctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53474669 |
tttcataccttcttgcttccaaggatcgtgattttctcctatcatcaactggaactcaggttctttatctttctatacctctcaccacttcagttttctg |
53474768 |
T |
|
| Q |
215 |
aatattcattcatgggttagtatat |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53474769 |
aatattcattcatgggttagtatat |
53474793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University