View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_124 (Length: 244)
Name: NF16091_high_124
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_124 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 227
Target Start/End: Complemental strand, 38822308 - 38822087
Alignment:
| Q |
9 |
ggtagataattctaacgacacagactatgaggtcagaaggatcatgcatccagaggttatttggatatagaaaaaagaattatttgtcctaccagtgcca |
108 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38822308 |
ggtatatatttctaacgacacagactatgaggtcagaaggatcatgcatccagaggttatttggatatagaaaaaagaattatttgtcctaccagtgcca |
38822209 |
T |
 |
| Q |
109 |
cttgtttgtctaaactgatggtccgtttagtcaagtactaacgataagattattaattgattaaaggaccaagacattataatacaatctta---ttata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38822208 |
cttgtttgtctaaactgatggtccgtttagtcaagtactaacgataagattattaattgattaaaggaccaagacattataatacaatcttattattata |
38822109 |
T |
 |
| Q |
206 |
tgaaattcatcacatggttgat |
227 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
38822108 |
tgaaattcatcacgtggttgat |
38822087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 38809213 - 38809150
Alignment:
| Q |
67 |
atttggatatagaaaaaagaattatttgtcctaccagtgccacttgtttgtctaaactgatggtc |
131 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
38809213 |
atttggatatagaaaaat-aaccatttgtcctaccggtgccacttgtttgtctaaactaatggtc |
38809150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 38809318 - 38809270
Alignment:
| Q |
9 |
ggtagataattctaacgacacagactatgaggtcagaaggatcatgcat |
57 |
Q |
| |
|
|||| ||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
38809318 |
ggtatatagttctaacgagacagattatgaggtcagaaggatcatgcat |
38809270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University