View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_126 (Length: 241)
Name: NF16091_high_126
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_126 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 7609210 - 7609392
Alignment:
| Q |
24 |
gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgtttgtatatttcaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
7609210 |
gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgattgtatattttgaa |
7609309 |
T |
|
| Q |
124 |
agttttgggatggtcgtttctttttctcttaagttgttattgtttgatgattgtagagagattttcatccatgtttagttcct |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609310 |
agttttgggatggtcctttctttttctcttaagttgtttttgtttgatgattgtagagagattttcatccatgtttagttcct |
7609392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 28559603 - 28559650
Alignment:
| Q |
148 |
tctcttaagttgttattgtttgatgattgtagagagattttcatccat |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
28559603 |
tctcttaagttgttattttttgatgattgtagagggatttccatccat |
28559650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University