View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_132 (Length: 237)
Name: NF16091_high_132
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_132 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 35867679 - 35867883
Alignment:
| Q |
15 |
atgaaggacagggagggtgttttnnnnnnnggagaggaaagagaaagaggaaggattgtgccagaaatattaatgaagcgagtgtgagagaaagtgattt |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867679 |
atgaaggacagggagggtgttttaaaaaaaggagaggaaagagaaagaggaaggattgtgccagaaatattaatgaagcgagtgtgagagaaagtgattt |
35867778 |
T |
 |
| Q |
115 |
ttcaattgtcgtgtcccggttgaaagaaagttctaccagcaattgtggtgaggttgtcaaatcttctggtgtaactgaggagaacacaaacttgaaaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35867779 |
ttcaattgtcgtgtcccggttgaaagaaagttctaccagcaattgtggtgaggttgtcaaatcttctggtgtaactgaggagaacacgaacttgaaaaag |
35867878 |
T |
 |
| Q |
215 |
gatgg |
219 |
Q |
| |
|
||||| |
|
|
| T |
35867879 |
gatgg |
35867883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University