View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_136 (Length: 233)
Name: NF16091_high_136
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_136 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 191
Target Start/End: Complemental strand, 40942709 - 40942530
Alignment:
| Q |
12 |
tcgaagaaaatcgtgaataaggataagtttgttccaacattcaatgaaacaaaacctctgatccaaaggatctttaatagaccaccataagtgggaagta |
111 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942709 |
tcgaacaaaatcgtgaataaggacaagtttgttccaacattcaatgaaacaaaacctctgatccaaaggatctttaatagaccaccataagtgggaagta |
40942610 |
T |
|
| Q |
112 |
tctgcatgattgattgagataataaaaccaagagcttgtctaacttgtcacactgcaaatcgaaagggcatcaagccatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40942609 |
tctgcatgattgattgagataataaaaccaagagcttgtctaacttgtcacattgcaaatcgaaagggcatcaagccatt |
40942530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University