View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_137 (Length: 233)
Name: NF16091_high_137
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_137 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 36284578 - 36284790
Alignment:
| Q |
14 |
ttctatttttatccattcggatatggatgtcctaagatttctagatgtcgcacgcttatgaattgttgtaaaattgcattggggacaacaaaataatgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
36284578 |
ttctatttttatccattcggatatggatgtcctaagatttctagatgtcgcacgcttatgaattgttgtaaaattgcattagggacaacaaaataacgtg |
36284677 |
T |
|
| Q |
114 |
tcttgttgtctctttatggcgcaactccttcaatgttattgattttttatgattctataatctatatgttaattttcattgttttgaattaggtgaattt |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36284678 |
tcttgttgtctctttatggcgcgactccttcaatgttattgattttttatgattctataatctatatgttaattttcattgttttgaattaggtgaattt |
36284777 |
T |
|
| Q |
214 |
ctgttgatgatgt |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36284778 |
ctgttgatgatgt |
36284790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University