View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_147 (Length: 225)
Name: NF16091_high_147
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_147 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 44170319 - 44170126
Alignment:
| Q |
20 |
atttgataaaatcaaaatatgtatc-gtctgatcttcatccaacgccaagacctgctgattgtagcatatgcatagattctgaaatatcacatcacgtca |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44170319 |
atttgataaaatcaaaatatgtatttgtctgatcttcatccaacgccaagacctgctgattgtagcatatgcatagattctgaaatatcacatcacatca |
44170220 |
T |
 |
| Q |
119 |
tcatgtataa----catatgtttgtgtgacgttgtatgtatatgtctctttaacaacatctccatatctgctactcctcttgaagaataccgat |
208 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44170219 |
tcatgtattatttacatatgtttgtgtgacgttgtatgtatatgtctctttaacaacatctccatatctgctactcctcttgaagaataccgat |
44170126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University