View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_150 (Length: 219)
Name: NF16091_high_150
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_150 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 43869722 - 43869513
Alignment:
| Q |
10 |
tcttctcctacgatcagttgcataatcatatcctagcttctgattgttactgctattccaaacacatcttctcttttccaaccgaatatcttagttttct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43869722 |
tcttctcctacgatcagttgcataatcatatcctagcttccgattcttactgctattccaaacacatcttctcttttccaaccgcatatcttagttttct |
43869623 |
T |
|
| Q |
110 |
gattccaagtatcgtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43869622 |
gattccaagtatcgtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcata |
43869523 |
T |
|
| Q |
210 |
tttgatttga |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
43869522 |
tttgatttga |
43869513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 43869137 - 43869229
Alignment:
| Q |
123 |
gtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcatatttgatttga |
219 |
Q |
| |
|
|||||||| |||||||||||||| | |||||| ||| ||||||| | |||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
43869137 |
gtgttaatctgatctatgtctttttagtttttattatttccctccaacttatcattaatttttgtttcta----ttatgttttcatatttgatttga |
43869229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 31342581 - 31342621
Alignment:
| Q |
149 |
gtttttgttacttccctctgatttatcattgattgttgttt |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
31342581 |
gtttttgttatttccctctgatttatcattaatttttgttt |
31342621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University