View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_157 (Length: 212)
Name: NF16091_high_157
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_157 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 43383300 - 43383193
Alignment:
| Q |
6 |
gatgatgaatatgatgattccccacccaattccttacgcttcttcttaccagtaacattaacagaatcatctttcatcctgtattgatcaccactactat |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
43383300 |
gatgatgatgatgatgattccccacccaattccttactcttcttcttaccagtaacagta------tcatctttcatcctgtattgatcaccactactat |
43383207 |
T |
|
| Q |
106 |
gatcatcggaccaa |
119 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43383206 |
gatcatcggaccaa |
43383193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 25870017 - 25869981
Alignment:
| Q |
16 |
atgatgattccccacccaattccttacgcttcttctt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870017 |
atgatgattccccacccaattccttacgcttcttctt |
25869981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University