View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_161 (Length: 207)
Name: NF16091_high_161
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_161 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 175
Target Start/End: Original strand, 29231754 - 29231919
Alignment:
| Q |
10 |
gtgagatgaacatttatttaacaaacagtaatcaattacaggcaatatattgttggtacatgttatggatgattattgtctaaaatctatttgaaatcag |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29231754 |
gtgaaatgaacatttatttaacaaacagtaatcaattacaggcaatatattggaggtacatgttatggatgattattgtctaaaatctatttgaaatcag |
29231853 |
T |
|
| Q |
110 |
tctgaaaattacatttttctggcagtggcttctttaatttacattttaccatttatctaaaaatta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29231854 |
tctgaaaattacatttttctggcagtggcttctttaatttacattttaccgtttatctaaaaatta |
29231919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University