View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_high_97 (Length: 293)
Name: NF16091_high_97
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_high_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 276
Target Start/End: Original strand, 48888696 - 48888957
Alignment:
| Q |
15 |
ttatactctgctaaggatctagatcaaagcccaaagtccttatctggtcacatgaagaatatcactgttttgaatctgctcaacaaaagtgaaaagatgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888696 |
ttatactctgctaaggatctagatcaaagcccaaagtccttatctggtcacatgaagaatatcactgttttgaatctgctcaacaaaagtgaaaagatgc |
48888795 |
T |
 |
| Q |
115 |
ttttgtctagcagctatgatggagtgatcattagatggattccaggcattggctatagtggtaagtttgacagtaaacaatttggattaatcaaattgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888796 |
ttttgtctagcagctatgatggagtgatcattagatggattccaggcattggctatagtggtaagtttgacagtaaacaatttggattaatcaaattgtt |
48888895 |
T |
 |
| Q |
215 |
agcagctgctgaagaagaagttgttacttctggatttgacaacaaggtaactgatatatatg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888896 |
agcagctgctgaagaagaagttgttacttctggatttgacaacaaggtaactgatatatatg |
48888957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University