View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_112 (Length: 277)
Name: NF16091_low_112
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 24 - 205
Target Start/End: Original strand, 7609210 - 7609391
Alignment:
| Q |
24 |
gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgtttgtatatttcaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
7609210 |
gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgattgtatattttgaa |
7609309 |
T |
 |
| Q |
124 |
agttttgggatggtcgtttctttttctcttaagttgttattgtttgatgattgtagagagattttcatccatgtttagttcc |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609310 |
agttttgggatggtcctttctttttctcttaagttgtttttgtttgatgattgtagagagattttcatccatgtttagttcc |
7609391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 28559603 - 28559650
Alignment:
| Q |
148 |
tctcttaagttgttattgtttgatgattgtagagagattttcatccat |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
28559603 |
tctcttaagttgttattttttgatgattgtagagggatttccatccat |
28559650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 266
Target Start/End: Original strand, 7609419 - 7609451
Alignment:
| Q |
234 |
catccatgttcacttttcttcacaattcatctc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7609419 |
catccatgttcacttttcttcacaattcatctc |
7609451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University