View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_116 (Length: 267)
Name: NF16091_low_116
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_116 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 18242850 - 18243084
Alignment:
| Q |
18 |
tgctcatacataaattttgtacatatgcaaaatatatctcaattacaatcaacaacnnnnnnnnnnnnnnnnnnnncgaaatgtcgatttcaggttcaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18242850 |
tgctcatacataaattttgtacatatgcaaaatgtatctcaattacaatcaacaacttttttctctttctttttctcgaaatgtcgatttcaggttcaaa |
18242949 |
T |
 |
| Q |
118 |
aatatctaactaatgtgataatccaagaatcatgcaaatgcaactggtggctatagattcttcttgttaactggaagactaatgtcgcgattattaacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
18242950 |
aatatctaactaatgtgataatccaagaatcatgcaaatgcaactggtggctatggattcttcttgctaactggaatactaatgtcgcgattattaacaa |
18243049 |
T |
 |
| Q |
218 |
ctaattgtcatgcattagtcccacatgaactttgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18243050 |
gtaattgtcatgcattagtcccacatgaactttgt |
18243084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University