View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_124 (Length: 257)
Name: NF16091_low_124
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 35867456 - 35867204
Alignment:
| Q |
1 |
gtgattctggtccaactgattcgttgtcaacatgacaatcatctcttttcccagctgtatctgtcaacttatctatattcaaaactttctcatgttcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867456 |
gtgattctggtccaactgattcgttgtcaacatgacaatcatctcttttcccagctgtatctgtcaacttatctatattcaaaactttctcatgttcaat |
35867357 |
T |
 |
| Q |
101 |
agaccctgaaacaccagccgaaatctccatgtcttcagaagacattgctggaacctggcattcatgagaccagtttgtatcggtttggtgtgtaaaactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867356 |
agaccctgaaacaccagccgaaatctccatgtcttcagaagacattgctggaacctggcattcatgagaccagtttgtatcggtttggtgtgtaaaactc |
35867257 |
T |
 |
| Q |
201 |
ccagcagatagcccatcctttgacaactctttactggaagattcatctctctc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35867256 |
ccagcagatagcccatcctttgacaactctttactggaagattcaactctctc |
35867204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 60 - 253
Target Start/End: Complemental strand, 35867670 - 35867477
Alignment:
| Q |
60 |
tctgtcaacttatctatattcaaaactttctcatgttcaatagaccctgaaacaccagccgaaatctccatgtcttcagaagacattgctggaacctggc |
159 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||| || ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
35867670 |
tctgtcaacttatctacattcaaaaccttctcatgttcagttgaccctgaaacaccaggcgtaatttccatgtcttcagaagacattgctggaatttggc |
35867571 |
T |
 |
| Q |
160 |
attcatgagaccagtttgtatcggtttggtgtgtaaaactcccagcagatagcccatcctttgacaactctttactggaagattcatctctctc |
253 |
Q |
| |
|
|||||||| |||||||||| | |||||| |||||||||||||||||||||| ||||||||||||| ||||||| | ||||||||| ||||||| |
|
|
| T |
35867570 |
attcatgaaaccagtttgtctgggtttgatgtgtaaaactcccagcagataacccatcctttgacgtctctttagttgaagattcaactctctc |
35867477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 35867180 - 35867134
Alignment:
| Q |
4 |
attctggtccaactgattcgttgtcaacatgacaatcatctcttttc |
50 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35867180 |
attctggtccaactgagttgttgtcaacatgacaatcatctcttttc |
35867134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University