View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_151 (Length: 227)
Name: NF16091_low_151
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_151 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 36187856 - 36187747
Alignment:
| Q |
16 |
ttatactctttaattctcacaaggaaaataatccaaggacaccaaaatacctattttacacattgaatttgagagagatgtaatagatgagatatattgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36187856 |
ttatactctttaattctcacaaggaaaataatccaaggacaccaaaatacatattttacacgttgaa-ttgagagagatgtaatagatgagatatattgg |
36187758 |
T |
|
| Q |
116 |
tgatttaagtg |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
36187757 |
tgatttaagtg |
36187747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 36187718 - 36187661
Alignment:
| Q |
154 |
caatgtatactattaaaagattcaaaccccaccccccattcaataaattcgtagattc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36187718 |
caatgtatactattaaaagattcaaaccccaccccccattcaataaattcgtagattc |
36187661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University