View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_163 (Length: 213)
Name: NF16091_low_163
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_163 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 43742387 - 43742216
Alignment:
| Q |
19 |
taggcaattaatgaggaaaatcaaaatatgaccataaattagtctaaatttccagttttcatgacatnnnnnnngatgtagaggaattggcgtttaagat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43742387 |
taggcaattaatgaggaaaatcaaaatatgaccataaattagtctaaatttccagttttcatgacatgaaaaaagatgtagaggaattggcgtttaagat |
43742288 |
T |
 |
| Q |
119 |
cggaagacaatgacttagtgggaaaggattagaaaataagggaagagaaagagactgcttgttcaaaccagt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43742287 |
cggaagacaatgacttagtgggaaaggattagaaaataagggaagagaaagagactgcttgttcaaaccagt |
43742216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University