View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_68 (Length: 374)
Name: NF16091_low_68
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_68 |
 | |
|
| [»] scaffold0197 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0197 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 11342 - 11594
Alignment:
| Q |
1 |
aaaaatttacccttcttcaagtttttctagtgagtgtgtgtagagagaaaattatctatattccactctacaatattatgtgtgaaagaagacatcttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11342 |
aaaaatttacccttcttcaagtttttctagtgagtgt--gtagagagaaaattatctatattccactctacaatattatgtgtgaaagaagacatcttat |
11439 |
T |
|
| Q |
101 |
gatggttatgataagattataagtgtcatactcatacataaaatcatttctttagaaatatttggcactgagaataatcgaacccgaaaccttgatgacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
11440 |
gatggttatgataagattataagtgtcatactcatacataaaatcatttctgtagaaatatttggcactgagaataatcgaacccaaaactttgatgacg |
11539 |
T |
|
| Q |
201 |
agtacactccaaagtctcaagtcaactctatcagaccaactcaattgggttattc |
255 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11540 |
agtacactttaaggtctcaagtcaacgctatcagaccaacccaattgggttattc |
11594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 258 - 351
Target Start/End: Original strand, 11654 - 11747
Alignment:
| Q |
258 |
atcatgaaatatggttatcatggattccaaagttaaaatggccctagcaaccaattaagatgttaaccaatatctcaaattttatgttgatagt |
351 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654 |
atcatgaaatatggttatcatggattcaaaagttaaaatggccctagcaaccaattaagatgttaaccaatatctcaaattttatgttgatagt |
11747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 9877021 - 9876974
Alignment:
| Q |
204 |
acactccaaagtctcaagtcaactctatcagaccaactcaattgggtt |
251 |
Q |
| |
|
||||||||||||||||||||||| | |||||| |||||||| |||||| |
|
|
| T |
9877021 |
acactccaaagtctcaagtcaacaccatcagatcaactcaaatgggtt |
9876974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University