View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_77 (Length: 343)
Name: NF16091_low_77
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 37 - 328
Target Start/End: Complemental strand, 15407190 - 15406899
Alignment:
| Q |
37 |
ttcccttatctccctctctccaattttcttcatctttcttttctatgggaaattgtcaagctgttgatgctgcagttcttgtgatccaacatccatgtgg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15407190 |
ttcccttatctccctctctccaattttcttcatctttcttttctatgggaaattgtcaagctgttgatgctgcagttcttgtgatccaacatccatgtgg |
15407091 |
T |
|
| Q |
137 |
gaagatagatagattgtattggccagtaactgctagtgaagttatgaaaaccaatcctggtcactatgtttcattgattatgccattacctcctcaacct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15407090 |
gaagatagatagattgtattggccagtaactgctagtgaagttatgaaaaccaatcctggtcactatgtttcattgattatgccattacctcctcaacct |
15406991 |
T |
|
| Q |
237 |
caagaacagaatcaagaacaaaagacagttaggtttactcgtgttaagttgcttaggcctaatgaaactcttaatcttggtcatgcttatag |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406990 |
caagaacagaatcaagaacaaaagacagttaggtttactcgtgttaagttgcttaggcctaatgaaactcttaatcttggtcatgcttatag |
15406899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 206
Target Start/End: Original strand, 44080798 - 44080923
Alignment:
| Q |
81 |
atgggaaattgtcaagctgttgatgctgcagttcttgtgatccaacatccatgtgggaagatagatagattgtattggccagtaactgctagtgaagtta |
180 |
Q |
| |
|
|||||||||||||||||| ||||| | ||| |||||| || ||||| ||| ||| || ||| || |||||||||||||| |||||||||||||| | |
|
|
| T |
44080798 |
atgggaaattgtcaagctattgatacagcaactcttgtaatacaacaaccaaatggtaaagaagaaaggttgtattggccagtcactgctagtgaagtga |
44080897 |
T |
|
| Q |
181 |
tgaaaaccaatcctggtcactatgtt |
206 |
Q |
| |
|
|||| || | |||| |||||||||| |
|
|
| T |
44080898 |
tgaagacacaccctgatcactatgtt |
44080923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University