View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16091_low_94 (Length: 314)
Name: NF16091_low_94
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16091_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 6 - 304
Target Start/End: Original strand, 29607122 - 29607420
Alignment:
| Q |
6 |
acatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtcccccagcaccactggctgatgataatactacaatg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607122 |
acatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtcccccagcaccactggctgatgataatactacaatg |
29607221 |
T |
|
| Q |
106 |
agttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatccttttccattttactttaagttacaattctatatttacggacctctttgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607222 |
agttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatctttttccattttactttaagttacaattctatatttacggacctctttgg |
29607321 |
T |
|
| Q |
206 |
tctggattatgccgcattaacgaattcatgcaatctttgtcatctgatctttatcagacagattgtactctgacttggcaaaacttgctaaagcttctt |
304 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607322 |
tctggatcatgccgcattaacgaattcatgcaatctttgtcatctgatctttatcagacagattgtactctgacttggcaaaacttgctaaagcttctt |
29607420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University