View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16093_high_23 (Length: 225)
Name: NF16093_high_23
Description: NF16093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16093_high_23 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 225
Target Start/End: Original strand, 54218942 - 54219153
Alignment:
| Q |
12 |
aaaaaaggaaattcagtgaaatttgaagacgcaacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttcaaatttgatgataaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218942 |
aaaaaaggaaattcagtgaaatttgaagacgcaacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttcaaatttgatgataaa |
54219041 |
T |
 |
| Q |
112 |
cctccggaacaaaatatgttgatctcctctagaactgtgtgccattttctgtcaaacactttaccaattggatttcaatttcatctccatcaaaatctga |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54219042 |
cctccggaacaaaatatgttgatcgcctctagaac--tgtggcattttctgtcaaacactttaacaattggatttcaatttcatctccatcaaaatctga |
54219139 |
T |
 |
| Q |
212 |
aaaagaacataatt |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54219140 |
aaaagaacataatt |
54219153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 96
Target Start/End: Original strand, 31217373 - 31217426
Alignment:
| Q |
43 |
caacttcccaggcctaaagattgcacgtggttcctcacatcagtcagcttcttc |
96 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
31217373 |
caacttcccatgcctaaagcttgcaattggttcctcacatcagccagcttcttc |
31217426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University