View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16093_low_20 (Length: 287)
Name: NF16093_low_20
Description: NF16093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16093_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 10 - 270
Target Start/End: Original strand, 38046312 - 38046572
Alignment:
| Q |
10 |
aagaaaatgttttgcctgtgaaaggggattcagtttctgaagttgaattggtaagcgagaagggaaactttcctaattcatctccatcaaagaaattgcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046312 |
aagaaaatgttttgcctgtgaaaggggattcagtttctgaagttgaattggtaagcgagaagggaaactttcctaattcatctccatcaaagaaattgcc |
38046411 |
T |
 |
| Q |
110 |
tatggcagctttgcttccacctgaagcaaataaatcaaccgagaaagagaatcatagtgaaaataaagtcactcctaagaatttcttttcaagcatgaag |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046412 |
tatggcagctttgcttccacccgaagcaaataaatcaaccgagaaagagaatcatagtgaaaataaagtcactcctaagaatttcttttcaagcatgaag |
38046511 |
T |
 |
| Q |
210 |
gatattgaagttctctttaatagagcttcggattctggcaaagaggttccaaggatgcttg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38046512 |
gatattgaagttctctttaatagagcttcggattctggcaaagaggttccaaggatgcttg |
38046572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 121 - 270
Target Start/End: Complemental strand, 35591187 - 35591038
Alignment:
| Q |
121 |
tgcttccacctgaagcaaataaatcaaccgagaaagagaatcatagtgaaaataaagtcactcctaagaatttcttttcaagcatgaaggatattgaagt |
220 |
Q |
| |
|
|||||||| ||||| ||||||| ||| |||| ||| ||||| |||||||||||| |||||| | |||||| |||||||||| || |||||| |
|
|
| T |
35591187 |
tgcttccagctgaaacaaataagtcagtggagacagaaaatcaccctgaaaataaagttgtacctaaggacttctttgcaagcatgaaagaaattgaatc |
35591088 |
T |
 |
| Q |
221 |
tctctttaatagagcttcggattctggcaaagaggttccaaggatgcttg |
270 |
Q |
| |
|
||||||| ||||| || || |||||||||||||||||||| ||||||| |
|
|
| T |
35591087 |
tctctttgtcagagcatctgaatctggcaaagaggttccaagaatgcttg |
35591038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University