View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16093_low_24 (Length: 237)
Name: NF16093_low_24
Description: NF16093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16093_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38367774 - 38367553
Alignment:
| Q |
1 |
ttattatcataattgcataataacctacacttactgaagcaacataagatattcggtgactgtatttactggtccagcattaatatatgaacattacaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367774 |
ttattatcataattgcataataacctacacttactgaagcaacataaaatattcggtgactgtatttactggtccagcattaatatatgaacattacaca |
38367675 |
T |
|
| Q |
101 |
cactaaaagcaaattgaaggatttatgtgtggacctgtcnnnnnnnnnnnnntaaagagaagaaaatagattggctagatgaattattaaaaatatatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367674 |
cactaaaagcaaattgaaggatttatgtgtggacctgtcaaaaagaaaaaaataaagagaagaaaatagattggctagatgaattattaaaaatatatgc |
38367575 |
T |
|
| Q |
201 |
atgttttattatcgtcattgat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38367574 |
atgttttattatcgtcattgat |
38367553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University