View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16093_low_27 (Length: 230)
Name: NF16093_low_27
Description: NF16093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16093_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 10662443 - 10662243
Alignment:
| Q |
13 |
acctgtggttgagccaggagatcaccttttttggttcaatagtcccaaccttattctctttataattcatcttgttctctttcaggtaatttcatcatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10662443 |
acctgtggttgagccaggagatcaccttttttggttcaatagtcccaaccttcttctctttataattcatcttgttctctttcaggtaatttcatcatgg |
10662344 |
T |
 |
| Q |
113 |
ttatcactatctcgatttgatactaaatttaaatttaactcaatcgatacgaatctctagtgtctatgtctatatttggacgtgcatctcatcttaaatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10662343 |
ttatcactatctcgatttgatactaaatttaaatttaactcaattgatacgaatttctagtgtctatgtctatatttgaacgtgcatctcatcttaaatc |
10662244 |
T |
 |
| Q |
213 |
g |
213 |
Q |
| |
|
| |
|
|
| T |
10662243 |
g |
10662243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 179
Target Start/End: Original strand, 30198070 - 30198107
Alignment:
| Q |
142 |
taaatttaactcaatcgatacgaatctctagtgtctat |
179 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
30198070 |
taaattgaactcaatcgaaacgaatctctagtgtctat |
30198107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University