View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16093_low_30 (Length: 213)
Name: NF16093_low_30
Description: NF16093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16093_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 12907150 - 12906968
Alignment:
| Q |
12 |
tgagatgaaatgtaacaggttttgagagaaggaaataaaggttatgggattctagtgtcttcagcaccaaaggaaagcaacgcaagttactctcttcgtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12907150 |
tgagatgaaatgtaacaggttttgagagaaggaaataaaggttatgggattctagtgtcttcagcaccaaaggaaagcaacgcaagttactctcttcgtg |
12907051 |
T |
|
| Q |
112 |
atccatccgaggtatttcccaattttcaactgagtttatacattatattttgggttgaatatatttttcatctaggtaaaatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12907050 |
atccatccgaggtatttcccaattttcaactgagtttatactttatattttgggttgaatatatttttcatctaggtaaaatg |
12906968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 70 - 177
Target Start/End: Original strand, 13313011 - 13313118
Alignment:
| Q |
70 |
cttcagcaccaaaggaaagcaacgcaagttactctcttcgtgatccatccgaggtatttcccaattttcaactgagtttatacattatattttgggttga |
169 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||| ||||||| |||| ||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
13313011 |
cttcagaaccaaaggaaagcaatgcaatttactcttgtcgtgattcatcagaggtatttcccagtttttaactgagttcatacattatattttgggttga |
13313110 |
T |
|
| Q |
170 |
atatattt |
177 |
Q |
| |
|
||| |||| |
|
|
| T |
13313111 |
ataaattt |
13313118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University