View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16094_high_3 (Length: 262)
Name: NF16094_high_3
Description: NF16094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16094_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 243
Target Start/End: Complemental strand, 25304116 - 25303875
Alignment:
| Q |
2 |
tagaggagaagcataggcaacccgatcgtttgaatacaaatcatttagaagaatatacggagaagtgtgctcggcttgttattcaggaggaggccttttg |
101 |
Q |
| |
|
||||||| | |||||||||||| ||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25304116 |
tagaggaaatgcataggcaacctaatcgtgtgaatacaaatcatttagaagaaaatatggagaagtgtgctcggcttgttattcaggaggaggccttttg |
25304017 |
T |
 |
| Q |
102 |
gaaacaaagagctaagatgcactggttgaaacaaagggacgtgaatacaaggttcttttacatgtccactgtttcgagaggtaaagtcaagaaagttata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
25304016 |
gaaacaaagagctaagatgcactggttgaaacaaagggacgtgaatagaaggttcttttacatgtccactgtttctagaggtaaagtcaagaaagttaca |
25303917 |
T |
 |
| Q |
202 |
aaactggtgtctgataatggttatttggttatgagataggag |
243 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25303916 |
aaactggtgtttgataatggttatttggttatgagataggag |
25303875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 131
Target Start/End: Original strand, 7124477 - 7124523
Alignment:
| Q |
85 |
caggaggaggccttttggaaacaaagagctaagatgcactggttgaa |
131 |
Q |
| |
|
||||||||||| |||||||| |||||||| || |||||||||||||| |
|
|
| T |
7124477 |
caggaggaggcgttttggaagcaaagagcaaaaatgcactggttgaa |
7124523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University