View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16094_high_5 (Length: 220)
Name: NF16094_high_5
Description: NF16094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16094_high_5 |
 |  |
|
| [»] scaffold0372 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0372 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: scaffold0372
Description:
Target: scaffold0372; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 3248 - 3436
Alignment:
| Q |
16 |
aaaggcgcacttcagtatttgttcggagagaaacatttctagatattgtatgtgatgctttggccgagtacaagtacttgggtccaaaccagagagcaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3248 |
aaaggcgcacttcagtatttgttcggagagaaacatttctagatattgtatgtgatgctttggccgagtacaagtacttgggtcctaaccagagagcaga |
3347 |
T |
 |
| Q |
116 |
cttggttctagcctgcaggtaacacattttttcatatctttaccgggcctatattgatctaataatctgaatagaagcgaggcaaaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3348 |
cttggttctagcctgcaggtaacaaattttttcatatctttaccgggactatattgatctaataatctgaatagaagtgaggcaaaaac |
3436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 21448288 - 21448100
Alignment:
| Q |
16 |
aaaggcgcacttcagtatttgttcggagagaaacatttctagatattgtatgtgatgctttggccgagtacaagtacttgggtccaaaccagagagcaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21448288 |
aaaggcgcacttcagtatttgttcggagagaaacatttctagatattgtatgtgatgctttggccgagtacaagtacttgggtcctaaccagagagcaga |
21448189 |
T |
 |
| Q |
116 |
cttggttctagcctgcaggtaacacattttttcatatctttaccgggcctatattgatctaataatctgaatagaagcgaggcaaaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21448188 |
cttggttctagcctgcaggtaacaaattttttcatatctttaccgggactatattgatctaataatctgaatagaagtgaggcaaaaac |
21448100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 30 - 136
Target Start/End: Original strand, 40684059 - 40684165
Alignment:
| Q |
30 |
gtatttgttcggagagaaacatttctagatattgtatgtgatgctttggccgagtacaagtacttgggtccaaaccagagagcagacttggttctagcct |
129 |
Q |
| |
|
||||||||| |||| ||||| ||| |||||||||| ||||||| | |||| |||||||| || |||||||||||||||||||||||||| | ||||| | |
|
|
| T |
40684059 |
gtatttgttaggagggaaacttttttagatattgtctgtgatgttctggctgagtacaaatatgtgggtccaaaccagagagcagacttgatgctagctt |
40684158 |
T |
 |
| Q |
130 |
gcaggta |
136 |
Q |
| |
|
||||||| |
|
|
| T |
40684159 |
gcaggta |
40684165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University