View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16096_high_4 (Length: 336)
Name: NF16096_high_4
Description: NF16096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16096_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 68 - 299
Target Start/End: Complemental strand, 44310942 - 44310711
Alignment:
| Q |
68 |
tgttccaactctgcatcacctgcacatctttgacaacaaaagttatggttcttatgccaacatattatttctcatcactcgaatttataaagtaaatttt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44310942 |
tgttccaactctgcatcacctgcacatctttgacaacaaaagttatggttcttatgccaacatattatttctcatcacttgaatttataaagtaaatttt |
44310843 |
T |
|
| Q |
168 |
ttgtcttctgtttatgtattactacataacttgattagtgaagatgttgcattgccaaaaagatataaatattgacctacatattagattgccaactaaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
44310842 |
ttgtcttctgtttatgtattactacataacttgattagtgaagatgttgcattgccaaaaagatataaatgttgacttacatattagattttcaactaaa |
44310743 |
T |
|
| Q |
268 |
aagctttcaactcactgcaatttttggattat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44310742 |
aagctttcaactcactgcaatttttggattat |
44310711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 44311024 - 44310985
Alignment:
| Q |
9 |
gcaatgaatatgatttccctttaattcttgactgagtatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311024 |
gcaatgaatatgatttccctttaattcttgactgagtatt |
44310985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University