View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1609_high_8 (Length: 250)

Name: NF1609_high_8
Description: NF1609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1609_high_8
NF1609_high_8
[»] chr6 (2 HSPs)
chr6 (78-206)||(24661496-24661623)
chr6 (1-37)||(24662239-24662275)
[»] chr3 (1 HSPs)
chr3 (1-71)||(19545660-19545729)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 78 - 206
Target Start/End: Complemental strand, 24661623 - 24661496
Alignment:
Q  78 aaaatcaaggatgttacagcatgcatccaaccaagatttgatcacatatcactttgtgaagtcnnnnnnnnncaatatgatgtctaccctctcttccatt 177  Q
    |||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||         || |||||||| ||||| ||||||||||    
T  24661623 aaaagcaaggatgttacagcatgcatccaaccaagatt-gattacatatcactttgtcaagtcttttttgtccagtatgatgtatacccgctcttccatt 24661525  T
Q  178 gaaccatatgaaagcattgcctgttgtgg 206  Q
    |||||||||||||||||||||||||||||    
T  24661524 gaaccatatgaaagcattgcctgttgtgg 24661496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 24662275 - 24662239
Alignment:
Q  1 cttgcatacacaaacatgtaaaattacataaaataat 37  Q
    |||||||||||| |||||||||||||| |||||||||    
T  24662275 cttgcatacacatacatgtaaaattacttaaaataat 24662239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 19545660 - 19545729
Alignment:
Q  1 cttgcatacacaaacatgtaaaattacataaaataatagctaactagtgatttataagacgaacatatata 71  Q
    |||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||    
T  19545660 cttgcacacacatacatg-aaaattacttaaaataatagctagctagtgatttataagacgaacatatata 19545729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University