View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1609_high_8 (Length: 250)
Name: NF1609_high_8
Description: NF1609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1609_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 78 - 206
Target Start/End: Complemental strand, 24661623 - 24661496
Alignment:
| Q |
78 |
aaaatcaaggatgttacagcatgcatccaaccaagatttgatcacatatcactttgtgaagtcnnnnnnnnncaatatgatgtctaccctctcttccatt |
177 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||| || |||||||| ||||| |||||||||| |
|
|
| T |
24661623 |
aaaagcaaggatgttacagcatgcatccaaccaagatt-gattacatatcactttgtcaagtcttttttgtccagtatgatgtatacccgctcttccatt |
24661525 |
T |
 |
| Q |
178 |
gaaccatatgaaagcattgcctgttgtgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24661524 |
gaaccatatgaaagcattgcctgttgtgg |
24661496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 24662275 - 24662239
Alignment:
| Q |
1 |
cttgcatacacaaacatgtaaaattacataaaataat |
37 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
24662275 |
cttgcatacacatacatgtaaaattacttaaaataat |
24662239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 19545660 - 19545729
Alignment:
| Q |
1 |
cttgcatacacaaacatgtaaaattacataaaataatagctaactagtgatttataagacgaacatatata |
71 |
Q |
| |
|
|||||| ||||| ||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19545660 |
cttgcacacacatacatg-aaaattacttaaaataatagctagctagtgatttataagacgaacatatata |
19545729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University