View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1609_low_5 (Length: 310)
Name: NF1609_low_5
Description: NF1609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1609_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 9 - 293
Target Start/End: Original strand, 42143710 - 42143994
Alignment:
| Q |
9 |
agcacagatcatagatactcgggctcgttaattatttggtcagaggtttgaccctgactactgtgaatnnnnnnnntattttagaagaggtcaaaccctt |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42143710 |
agcacagatcatagatacttgggctcgttaatcatttggtccgaggtttggccctgactactgtgaataaaaaaaatattttagaagaggtcaaaccctt |
42143809 |
T |
 |
| Q |
109 |
aaataaatctcagatatcttaagaatctaaggtacatacttgcgcaagaggatacattggtttgccnnnnnnnnnnnnnnnnnncagaaggtgtgtcaaa |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42143810 |
aaataaatctgagatatcttaagaatctaaggtacatacttgcgcaagaggatacattggtttgccaaaaaaataaaaaataaacagaaggtgtgtcaaa |
42143909 |
T |
 |
| Q |
209 |
gtttagcaatacaaagtccgagcttagtatcatcaattatcaaacaattcacgaatgagacaaaatccttcactatgctcagtct |
293 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42143910 |
gtttagcaatacaaagtccaagcttagtatcatcagttatcaaacaattcacgaatgagacaaaatccttcactatgctcagtct |
42143994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University