View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1609_low_9 (Length: 255)
Name: NF1609_low_9
Description: NF1609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1609_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 48724138 - 48723975
Alignment:
| Q |
1 |
gctcttgaatcgaaaatctggtttcattcattgtatgtgttgtttatggtaacttaatagagtatcatatatactttcataaaacttccattttagtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48724138 |
gctcttgaatcgaaaatctggtttcattcattgtatgtgttgtttatggtaacttaatagagtatcatatatactttcataaaacttccattttagtgta |
48724039 |
T |
|
| Q |
101 |
tataatactttcctaaaagtggtcttcaaattatcttataaaccttcaaattatcgatttctaagaa |
167 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48724038 |
t---atactttcctaaaagtggtcttcaaattatcttataaaccttcaaattatcgatttctaagaa |
48723975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 48723253 - 48723177
Alignment:
| Q |
164 |
agaatatagattgacgatgtcttttgacgggactagttaagctctactgttctgacttaatctaactaagctctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48723253 |
agaatatagattgacgatgtcttttgacgggactagttaagctctactgttctgacttaatctaactaagctctctg |
48723177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University