View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1610-Insertion-6 (Length: 88)
Name: NF1610-Insertion-6
Description: NF1610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1610-Insertion-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 30024829 - 30024909
Alignment:
| Q |
8 |
tgtgggcttccacaagtacccgtgcaacaatacttaggtgagttaaaagcataacaagcactcttacaacccaccacttga |
88 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30024829 |
tgtgggcttccataactacccgtgcaacaatactcaggtgagttaaaagcataacaagcactcttacagcccaccacttga |
30024909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University