View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16100_low_11 (Length: 230)
Name: NF16100_low_11
Description: NF16100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16100_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 48678813 - 48678603
Alignment:
| Q |
10 |
atccaagtattatttacttgaattttaacgtgcaaattgggtattaagtcttagtttaatcaataaataattatattagtgtttaatggagttggcacac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48678813 |
atccaagtattatttacttgaattttaacgtgcaaattgggtattaagtcttagtttaatcaataaataattatattagtgtttaatggagttggcacac |
48678714 |
T |
 |
| Q |
110 |
taggtgctcttatttgtttgattttacgaatgtcacttgtttgttcaacttgtgtaggatttacctttgacgatgcatagtatcgtaataggtgtcagct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48678713 |
taggtgctcttatttgtttgattttacgaatgtcacttgttggttcaacttgtgtagggtttacctttgacgatgcatagtatcgtaataggtgtcagct |
48678614 |
T |
 |
| Q |
210 |
atgtgaattaa |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
48678613 |
atgtgaattaa |
48678603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University