View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16102_low_14 (Length: 242)
Name: NF16102_low_14
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16102_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 38999407 - 38999619
Alignment:
| Q |
20 |
tttctagcatgatgaacatagacatcaagaagacctgtgaactctgcttcatcttcatcatctaattgggtagctctattcaaatttggattgtacctaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999407 |
tttctagcatgatgaacatagacatcaagaagacctgtgaactctgcttcatcttcatcatctaattgggtagctctattcaaatttggattgtacctaa |
38999506 |
T |
 |
| Q |
120 |
agttgttgttttgatgactctgattgaatgaatccattctaatcaatgtttttgccttgtatgtctgttcatcaatgttgaaccattaatttatccaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38999507 |
agttgttgttttgatgactctgattgaatgaatccattctaatcaatgtttttgccttgaatgtctgttcatcaatgttgaaccattaaattatccaatt |
38999606 |
T |
 |
| Q |
220 |
cctgcaccctttg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38999607 |
cctgcaccctttg |
38999619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University