View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16102_low_16 (Length: 236)
Name: NF16102_low_16
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16102_low_16 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 131 - 236
Target Start/End: Complemental strand, 25290673 - 25290568
Alignment:
| Q |
131 |
gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290673 |
gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg |
25290574 |
T |
|
| Q |
231 |
taaggt |
236 |
Q |
| |
|
|||||| |
|
|
| T |
25290573 |
taaggt |
25290568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 25290774 - 25290732
Alignment:
| Q |
18 |
gaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290774 |
gaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa |
25290732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University