View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16102_low_18 (Length: 202)
Name: NF16102_low_18
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16102_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 37 - 151
Target Start/End: Complemental strand, 54235333 - 54235219
Alignment:
| Q |
37 |
atgaaaagttagtgtattgttattgttatttgatgtgctttgtgcttaacttttttagcttgcgttggagtaccactgctatatatataagtagtaatca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54235333 |
atgaaaagttagtgtattgttattgttatttgatgtgctttgtgcttaacttttttagcttgcgttggagtaccactactatatatataagtagtaatca |
54235234 |
T |
 |
| Q |
137 |
caactgcactgtgta |
151 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54235233 |
caactgcactgtgta |
54235219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University