View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16102_low_9 (Length: 291)
Name: NF16102_low_9
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16102_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 258
Target Start/End: Original strand, 19788989 - 19789242
Alignment:
| Q |
8 |
cagcacagaagcgtttaagttcccatattgtccctttgatattgatgcagcacagtgcatgcaactatgtttgtgattttcatggatttgtattaaattg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19788989 |
cagcacagaagcgtttaagttcccatattgtccctttgatattgatgcagcacagtgcatgcaactatgtttgtgattttcatggatttgtattaaattg |
19789088 |
T |
 |
| Q |
108 |
tatcatctgatttacgctttagtatgatgattgcaatggcccatatagctagttgtgatgtc--tgtatgtttcatatacttgtaaataaaaattctttt |
205 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19789089 |
tatcatctgattcacgttttagtatgatgattgcaatggccc--atggctagttgtgatgtctgtgtatgtttcatatacttgtaaataaaaattctttt |
19789186 |
T |
 |
| Q |
206 |
taattctattttgaataatgaatgat---tcagtcttaacctattcagaatgtgaa |
258 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
19789187 |
taattctattttgaataatgtttcatagactagtcttaacctattcagaatgtgaa |
19789242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 21 - 132
Target Start/End: Original strand, 28173388 - 28173504
Alignment:
| Q |
21 |
tttaagttcccatattgtccctttgatattgatgcagcacagtgcatgcaactatgtttgtgattttcatggatttgtattaaa-----ttgtatcatct |
115 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||||| || |||||||| ||| ||||||||||| |
|
|
| T |
28173388 |
tttaagtgcccgtattgtccctttgatattgatgcagcacagtgcaagcaactatatttgtgattttcttgtatttgtatcaaactttcttgtatcatct |
28173487 |
T |
 |
| Q |
116 |
gatttacgctttagtat |
132 |
Q |
| |
|
|| ||||| ||||||| |
|
|
| T |
28173488 |
gaattacgtgttagtat |
28173504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 28173544 - 28173581
Alignment:
| Q |
157 |
tagttgtgatgtctgtatgtttcatatacttgtaaata |
194 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
28173544 |
tagttgtgatgtctgtatgttttacatacttgtaaata |
28173581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University