View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_high_10 (Length: 296)
Name: NF16104_high_10
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 35022382 - 35022646
Alignment:
| Q |
18 |
agcttgatgcgaattcggcttatgcagagatttatctgaagggattggtgaagcatttgaagtccggtgccggaacgccattgttgaaagatggagtgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022382 |
agcttgatgcgaattcggcttatgcagagatttatctgaagggattggtgaagcatttgaagtccggtgccggaacgccattgttgaaagatggagtgaa |
35022481 |
T |
 |
| Q |
118 |
aggggtttatctgtatgaattgtttgataaggaaggtgctggaaatggaaggaattgggggattttgtatccgaatggttcgacaaagtatgataagatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022482 |
aggggtttatctgtatgaattgtttgataaggaaggtgctggaaatggaaggaattgggggattttgtatccgaatggttcgacaaagtatgataagatt |
35022581 |
T |
 |
| Q |
218 |
gatttctcttctggatggaaaagattggtgaatgtgggtttcattttgttgctgattgttcttca |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022582 |
gatttctcttctggatggaaaagattggtgaatgtgggtttcattttgttgctgattgttcttca |
35022646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University