View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_high_18 (Length: 244)
Name: NF16104_high_18
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 35753644 - 35753417
Alignment:
| Q |
18 |
gatttctcagaaactatttatggcatgtcttgattatcagtaattgtctttttattacaagttgatatttgatttcctttcgtgataggttgtagac--- |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35753644 |
gatttctcggaaactatttatggcatgtcttgattatcagtaattgtctttttattacaagttgatacttgatttcctttcgtgataggttgtagacgta |
35753545 |
T |
|
| Q |
115 |
---cctgcttttgagttttagcgagactgtgtcggggagatcaagcttgtttgcattgcattaagaaaaagtgtgtgtggcttgtaatctatctaattcc |
211 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35753544 |
gaccctgcttttgagttttagtgagactgtgtcggggagatcaagcttgtttgcattgcattaagaaaaagtgtgtgtggcttgtaatctatctaattcc |
35753445 |
T |
|
| Q |
212 |
tgaaatatgagcgtggttctgtgctgct |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
35753444 |
tgaaatatgagcgtggttttgtgctgct |
35753417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University