View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_low_10 (Length: 328)
Name: NF16104_low_10
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 323
Target Start/End: Complemental strand, 489026 - 488723
Alignment:
| Q |
19 |
attagtttgaatctgcaaacagcttagctgctttcttggtaattgaacatgctttactaagctaacagagaagataannnnnnncattgaaatagaactg |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
489026 |
attagtttgaatctgtaaacagcttagctgctt-cttggtaattgaacatgctttactaagctaacagagaagataatttttttcattgaaatagaactg |
488928 |
T |
|
| Q |
119 |
ccaactttttagaatcagaagcacnnnnnnnn-tgtttcattatcctatagttttcaaattcattcaattttttcttgttctttgcactcttgattttct |
217 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
488927 |
ccaactttt-agaatcagaagaacaaaaaaaaatgtttcattatcctatagttttcaaattcattcaatttttccttgttctttacactcttgattttct |
488829 |
T |
|
| Q |
218 |
ttcatatcttgccttagcagatcctccatatgaaatttgctccacaagaaacatctatgcaaatggaagttcctttgataacaatctcagtaaccttctt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
488828 |
ttcatatcttgccttagcagatcctccatatgaaatttgttccacaagaaacatctatgcaaatggaagttcctttgataacaatctcagtaacctcctt |
488729 |
T |
|
| Q |
318 |
ctctct |
323 |
Q |
| |
|
|||||| |
|
|
| T |
488728 |
ctctct |
488723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University