View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_low_27 (Length: 232)
Name: NF16104_low_27
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 43453933 - 43453734
Alignment:
| Q |
16 |
atgaagaaagctattaagagcaagcatagaaaggattctgtgttctatatccttagcagaatttaatttatttacgaacggctttagcaaacagacacgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453933 |
atgaagaaagctattaagagcaagcatagaaaggattctgtgttctatatccttagcagaatttaatttatttacgaacggctttagcaaacagacacgg |
43453834 |
T |
|
| Q |
116 |
gctgctccttgtatccctgtatctggtagagtggtcagcatgtatatgagccacgtagctgatataaagcatgctgaacgtagctctggaattctactct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453833 |
gctgctccttgtatccctgtatctggtagagtggtcagcatgtatatgagccacgtagctgatataaagcatgctgaacgtagctctggaattctactct |
43453734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University