View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_low_29 (Length: 227)
Name: NF16104_low_29
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 27098898 - 27098703
Alignment:
| Q |
15 |
aagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098898 |
aagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttctc |
27098799 |
T |
|
| Q |
115 |
aaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatttcactaatcaaatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098798 |
aaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatttcactaatcaaatct |
27098703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University