View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_low_3 (Length: 489)
Name: NF16104_low_3
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 450; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 18 - 483
Target Start/End: Complemental strand, 40938396 - 40937931
Alignment:
| Q |
18 |
cttttgcggaattcattgcgaccttggaagcttcaagggtctttgtcataaaaaatttgattcaatttcatcagggttaattggcgcaaatttgttgtta |
117 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40938396 |
cttttgcggaatttattgcgaccctggaagcttgaagggtctttgtcataaaaaatttgattcaatttcatcagggttagttggcgcaaatttgttgtta |
40938297 |
T |
 |
| Q |
118 |
aaatggttgattcaattgctacaacttcacttctcggccaccgtcctgtttgtggtggaaatttgattagggatgtatctgcgaagaggaaatctttgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40938296 |
aaatggttgattcaattgctacaacttcacttctcggccaccgtcctgtttgtggtggaaatttgattagggatgtatctgcgaagaggaaatctttgaa |
40938197 |
T |
 |
| Q |
218 |
catttgtaggtttacaccagctgagtttcttggtggaagggttgttgtttcactacctttgactaaatcgaaacaagatgggtttttgtcgtgttcgtca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40938196 |
catttgtaggtttacaccagctgagtttcttggtggaagggttgttgtttcactacctttgactaaatcgaaacaagatgggtttttgtcgtgttcgtca |
40938097 |
T |
 |
| Q |
318 |
attaaggcccttgctgtcgagcttacaagagaagcatatgcttatagagaagataagttgccaaagaaaggtaatagtaagattgatggtggatttgatc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40938096 |
attaaggcccttgctgtcgagcttacaagagaagcatatgcttatagagaagataagttgccaaagaaaggtaatagtaagattgatggtggatttgatc |
40937997 |
T |
 |
| Q |
418 |
gaaaacctggtttgtggccaccggaaaatagagcagataagccttcgcttagaaaccctttgcttc |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937996 |
gaaaacctggtttgtggccaccggaaaatagagcagataagccttcgcttagaaaccctttgcttc |
40937931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University