View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16104_low_5 (Length: 432)
Name: NF16104_low_5
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16104_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 52824416 - 52824640
Alignment:
| Q |
13 |
attattctgaaaaaatggataacagatcaaacaccgtcaatttcagcagcagtttgggggatttcacagttccacagataacaatccctcccaattaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824416 |
attattctgaaaaaatggataacagatcaaacaccgtcaatttcagcagcagtttgggggatttcacagttccacagataacaatccctcccaattaaca |
52824515 |
T |
 |
| Q |
113 |
ttgtcacatcttatnnnnnnnnnnnnncaacaatgatatagacatatctttagatttcatacattcattcaacatctgattttctctctagcactcttct |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824516 |
ttgtcacatcttattatatatatatatcaacaatgatatagacatatctttagatttcatacattcattcaacatctgattttctctctagcactcttct |
52824615 |
T |
 |
| Q |
213 |
tttcacatcatcaaactatcatatc |
237 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
52824616 |
tttcacatcatcaaactgtcatatc |
52824640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 284 - 417
Target Start/End: Original strand, 52824696 - 52824830
Alignment:
| Q |
284 |
agatgtatacactacaggg-tgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttc |
382 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824696 |
agatgtatacactacaggggtgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttc |
52824795 |
T |
 |
| Q |
383 |
ttcataaatcagtgtaaaatattaaatatttcttt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52824796 |
ttcataaatcagtgtaaaatattaaatatgtcttt |
52824830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University