View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16105_high_10 (Length: 403)
Name: NF16105_high_10
Description: NF16105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16105_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 30769810 - 30769425
Alignment:
| Q |
1 |
ccacgaccacgattctggtgtcaccgcctacataacataaagacttatcgtgagggcgcggcattatgtggcctccgtagctgcacatgagccgaagctt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30769810 |
ccacgaccacgattctggtgtcaccacctacataacatagagacttatcatgagggcgcggcattatgtggcctccgtagctgcacattagccgaagctt |
30769711 |
T |
 |
| Q |
101 |
gcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatcgtggtggtggctgtggtggtggcgatgataaagactcgaccgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769710 |
gcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatcgtggtggtggctgtggtggtggcgatgataaagactcgaccgat |
30769611 |
T |
 |
| Q |
201 |
tcaggatagttttgttggatgatgttatgaggaatggtggttgcggcggtggagataagtggtggatccattagaattggtgagttttggaataaaatga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769610 |
tcaggatagttttgttggatgatgttatgaggaatggtggttgcggcggtggagataagcggtggatccattagaattggtgagttttggaataaaatga |
30769511 |
T |
 |
| Q |
301 |
aacggagcggaacagaacagaatagagtctctgatcactctacttagtttggtgcagagtgaaaacaggggagaaacagagttagt |
386 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769510 |
aacggagcggaacagaacaggatggagtctctgatcactctgcttagtttggtgcagagtgaaaacaggggagaaacagagttagt |
30769425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University