View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16105_high_34 (Length: 217)
Name: NF16105_high_34
Description: NF16105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16105_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 13134337 - 13134154
Alignment:
| Q |
18 |
agggacggtcgagatgtgtctatttgaggtggggaaagatctgggctctccatcatcatcatatataccttt---aagctcttataactttgcttgttct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13134337 |
agggacggtcgagatgtgtctatttgaggtggggaaagatctgggctctccatcatcatcatatatacctttgataagctcttataactttgcttgttct |
13134238 |
T |
 |
| Q |
115 |
gatgatgctggtggtggtgttcttcttaaaatactaatactcaaatatgtatgtgtgtgtagttgaggaaattaaggaaggata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13134237 |
gatgatgctggtggtggtgttcttcttaaaatactactactcaaatatgtatgtgtgtgtagttgaggaaattaaggaaggata |
13134154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 41 - 197
Target Start/End: Original strand, 30237302 - 30237452
Alignment:
| Q |
41 |
ttgaggtggggaaagatctgggctctccatcatcatcatatataccttt---aagctcttataactttgcttgttctgatgatgctggtggtggtgttct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||| ||||||||||||| | |||||| | |||| |
|
|
| T |
30237302 |
ttgaggtggggaaagatctgggctctccatcatcat-----atacctttgataatctcttataactt-gcttgttctgatg---ccagtggtgttattct |
30237392 |
T |
 |
| Q |
138 |
tcttaaaatactaatactcaaatatgtatgtgtgtgtagttgaggaaattaaggaaggat |
197 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30237393 |
tcttaaaatactactactcatatatggatgtgtgtgtagttgaggaaattaaggaaggat |
30237452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University