View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16105_high_35 (Length: 217)
Name: NF16105_high_35
Description: NF16105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16105_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 46 - 205
Target Start/End: Complemental strand, 45342808 - 45342649
Alignment:
| Q |
46 |
catgagcaatcctcttcttggatggaataacttgcatgttccattttgtataagtaaagttaatcctttttcttgaagctggcctacactcagtaagtta |
145 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
45342808 |
catgaacaatcctcttctttgatggaataacttgcatgtttcattttgtataagtaaagttaatcctttttcttgaagttggcctacattcagtaagtta |
45342709 |
T |
 |
| Q |
146 |
tttttcaactctggaacatagtagacatcagtgactacttgaattgcaccattcatctca |
205 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45342708 |
tttttcaactttggaacatagtagacatcagtgactacttgaattgcaccattgatctca |
45342649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University