View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16105_low_35 (Length: 231)
Name: NF16105_low_35
Description: NF16105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16105_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35106872 - 35106663
Alignment:
| Q |
1 |
tactagcttcatgagaatcagacaatgccatgcgactctctcgtcccaaatctatgacttccatgaaactaaagattgggacctccttattttcttcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106872 |
tactagcttcatgagaatcagacaatgccatgcgactctctcgtcccaaatctatgacttccatgaaactaaagattgggacctccttattttcttcagc |
35106773 |
T |
 |
| Q |
101 |
gatcagattcaggtctgatttttctccccaaagcaaaataataaatctcatgccagtctttgaatagaatggttttgcaattcggataaacatttcaggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35106772 |
gatcagattcaggtctgatttttctccccaaagcaaaataataaatctcatgccagtctttgaatagaatggttttgcaattcggttaaacatttcaggg |
35106673 |
T |
 |
| Q |
201 |
ccatccacgg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35106672 |
ccatccacgg |
35106663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 116 - 181
Target Start/End: Original strand, 38121810 - 38121875
Alignment:
| Q |
116 |
tgatttttctccccaaagcaaaataataaatctcatgccagtctttgaatagaatggttttgcaat |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || ||||| |||| |||||||||||||| |
|
|
| T |
38121810 |
tgatttttctccccaaagcagaataataaatctgattgaggtcttcaaataaaatggttttgcaat |
38121875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University