View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16105_low_7 (Length: 498)
Name: NF16105_low_7
Description: NF16105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16105_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 460; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 460; E-Value: 0
Query Start/End: Original strand, 18 - 481
Target Start/End: Original strand, 42450568 - 42451031
Alignment:
| Q |
18 |
ggaggaattaaggaagcttatgggaatgaaacaagttcaagttcctgttgtgtttgtgaagggaaggtttgttggaggagtggatgaagttatgaaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42450568 |
ggaggaattaaggaagcttatgggaatgaaacaagttcaagttcctgttgtgtttgtgaagggaaggtttgttggaggagtggatgaaattatgaaattg |
42450667 |
T |
|
| Q |
118 |
gaagatgaagaaaaattaggtgttcttttggaagggattccaagggcattaggagtttgtgaagggtgtggaagtttgaggtttgtgatgtgtaaggaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450668 |
gaagatgaagaaaaattaggtgttcttttggaagggattccaagggcattaggagtttgtgaagggtgtggaagtttgaggtttgtgatgtgtaaggaat |
42450767 |
T |
|
| Q |
218 |
gtaatggaagttgtaaggttttggatgagaagcaaaagaaaacggttaagtgtggttattgcaatgaaaatggaataattagatgctctttgtgttgttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450768 |
gtaatggaagttgtaaggttttggatgagaagcaaaagaaaacggttaagtgtggttattgcaatgaaaatggaataattagatgctctttgtgttgttg |
42450867 |
T |
|
| Q |
318 |
aagaaaactgatttgatgtgtggtttgttagtttggatttttaggttgatttctgattcttaatttctaggaagagatggaacaagcatgttgcttgatc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450868 |
aagaaaactgatttgatgtgtggtttgttagtttggatttttaggttgatttctgattcttaatttctaggaagagatggaacaagcatgttgcttgatc |
42450967 |
T |
|
| Q |
418 |
ctttacattgttcctaggagtagggttctaaagcgtgttttagtcccttatttattgttgattc |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450968 |
ctttacattgttcctaggagtagggttctaaagcgtgttttagtcccttatttattgttgattc |
42451031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University