View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16107_low_11 (Length: 234)
Name: NF16107_low_11
Description: NF16107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16107_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 4395068 - 4395275
Alignment:
| Q |
22 |
gcagatgtaggaaagaaaatgctggagagtg--atgaggttttaatgtatggtgttttatttggttgttgtctattttgatgacttgctgatttcttctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4395068 |
gcagatgtaggaaagaaaatgctggagagtgtgatgaggttttaatgtatggtattttatttggttgttgtctattttgatgacttgctgattttttctt |
4395167 |
T |
 |
| Q |
120 |
tctgttatattatgtcattgtactattgtgtttgctattagggttattattcaatagaggtttatagaagaacactgctcatgagaatgacttcagatat |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395168 |
tctgttatattatgtcaatgtactattgtgtttgctattagggttattattcaatagaggtttatagaagaacactgctcatgagaatgacttcagatat |
4395267 |
T |
 |
| Q |
220 |
ctgtgctg |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
4395268 |
ctgtgctg |
4395275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University