View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16107_low_5 (Length: 324)
Name: NF16107_low_5
Description: NF16107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16107_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 314
Target Start/End: Original strand, 45317178 - 45317475
Alignment:
| Q |
18 |
ctcgtatcatacctataataggtctcttcagtcataaaattaattttgttgtattgttcttatgataannnnnnngtcagaaattaatctgaatcaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45317178 |
ctcgtatcatacctataataggtctcttcagtcataaaattaattttgttgtattgttcttatgataatttttttgtcagaaattaatctgaatcaatta |
45317277 |
T |
|
| Q |
118 |
ttgatatatggatctgctttttctagcaccctagataatattatttgttttatatctcaaatcaaagttaattgataatgatctcctagtcatggaattg |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45317278 |
ttgatgtatggatctgctttttctagcaccctagataataatatttgttttatatctcaaatcaaagttaattgataatgatctcctagtcatggaattg |
45317377 |
T |
|
| Q |
218 |
aatcatggaacatggcagcg-ttttttctctttaattttcacattataattagtcttatgtcctattgtcctgtttgattgattctgtaagtcctatg |
314 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45317378 |
aatcatggaacatggcagcgtttttttctctttaattttcacattataattagtcttatgtcctattgtcctgtttgattgattctctaagtcctatg |
45317475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University